| Assay Method Information | |
| | ChEMBL_1801108 (CHEMBL4273400) |
| Description: | Inhibition of HIV integrase strand transfer activity expressed in Escherichia coli BL21 (DE3) using 5' biotin ATGTGGAAAATCTCTAGCA primer annealed with ACTGCTAGAGATTTTCCACAT 3' Cy5 template preincubated for 10 mins followed by primer/template addition measured after 30 mins by fluorescence assay |
| Affinity data for this assay | |
|---|---|
| If you find an error in this entry please send us an E-mail | |